assemblerflow.templates.fastqc module¶
Purpose¶
This module is intended to run FastQC on paired-end FastQ files.
Expected input¶
The following variables are expected whether using NextFlow or the
main() executor.
fastq_pair: Pair of FastQ file paths- e.g.:
'SampleA_1.fastq.gz SampleA_2.fastq.gz'
- e.g.:
Generated output¶
The generated output are output files that contain an object, usually a string.
pair_{1,2}_data: File containing FastQC report at the nucleotide level for each pair- e.g.:
'pair_1_data'and'pair_2_data'
- e.g.:
pair_{1,2}_summary: File containing FastQC report for each category and for each pair- e.g.:
'pair_1_summary'and'pair_2_summary'
- e.g.:
Code documentation¶
-
assemblerflow.templates.fastqc.convert_adatpers(adapter_fasta)[source]¶ Generates an adapter file for FastQC from a fasta file.
The provided adapters file is assumed to be a simple fasta file with the adapter’s name as header and the corresponding sequence:
>TruSeq_Universal_Adapter AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT >TruSeq_Adapter_Index 1 GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG
Parameters: - adapter_fasta : str
Path to Fasta file with adapter sequences.
Returns: - adapter_out : str or None
The path to the reformatted adapter file. Returns
Noneif the adapters file does not exist or the path is incorrect.