#!/usr/bin/env python3
"""
Purpose
-------
This module receives paired FastQ files, a genome size estimate and a minimum
coverage threshold and has three purposes while iterating over the FastQ files:
- Checks the integrity of FastQ files (corrupted files).
- Guesses the encoding of FastQ files (this can be turned off in the \
``opts`` argument).
- Estimates the coverage for each sample.
Expected input
--------------
The following variables are expected whether using NextFlow or the
:py:func:`main` executor.
- ``fastq_id`` : *Sample Identification string*
- e.g.: ``'SampleA'``
- ``fastq_pair`` : *Pair of FastQ file paths*
- e.g.: ``'SampleA_1.fastq.gz SampleA_2.fastq.gz'``
- ``gsize`` : *Expected genome size*
- e.g.: ``'2.5'``
- ``cov`` : *Minimum coverage threshold*
- e.g.: ``'15'``
- ``opts`` : *Specify additional arguments for executing integrity_coverage. \
The arguments should be a string of command line arguments, such as \
'-e'. The accepted arguments are:*
- ``'-e'`` : Skip encoding guess.
Generated output
----------------
The generated output are output files that contain an object, usually a string.
(Values within ``${}`` are substituted by the corresponding variable.)
- ``${fastq_id}_encoding`` : Stores the encoding for the sample FastQ. If no \
encoding could be guessed, write 'None' to file.
- e.g.: ``'Illumina-1.8'`` or ``'None'``
- ``${fastq_id}_phred`` : Stores the phred value for the sample FastQ. If no \
phred could be guessed, write 'None' to file.
- ``'33'`` or ``'None'``
- ``${fastq_id}_coverage`` : Stores the expected coverage of the samples, \
based on a given genome size.
- ``'112'`` or ``'fail'``
- ``${fastq_id}_report`` : Stores the report on the expected coverage \
estimation. This string written in this file will appear in the \
coverage report.
- ``'${fastq_id}, 112, PASS'``
- ``${fastq_id}_max_len`` : Stores the maximum read length for the current \
sample.
- ``'152'``
Notes
-----
In case of a corrupted sample, all expected output files should have
``'corrupt'`` written.
Code documentation
------------------
"""
__version__ = "1.0.0"
__build__ = "16012018"
__template__ = "integrity_coverage-nf"
import os
import bz2
import gzip
import json
import zipfile
from itertools import chain
from assemblerflow_utils.assemblerflow_base import get_logger, MainWrapper
logger = get_logger(__file__)
# Set constants when running from Nextflow
if __file__.endswith(".command.sh"):
# CONSTANTS
FASTQ_PAIR = '$fastq_pair'.split()
FASTQ_ID = '$fastq_id'
GSIZE = float('$gsize')
MINIMUM_COVERAGE = float('$cov')
OPTS = '$opts'.split()
logger.debug("Running {} with parameters:".format(
os.path.basename(__file__)))
logger.debug("FASTQ_ID: {}".format(FASTQ_ID))
logger.debug("FASTQ_PAIR: {}".format(FASTQ_PAIR))
logger.debug("GSIZE: {}".format(GSIZE))
logger.debug("MINIMUM_COVERAGE: {}".format(MINIMUM_COVERAGE))
logger.debug("OPTS: {}".format(OPTS))
RANGES = {
'Sanger': [33, (33, 73)],
'Illumina-1.8': [33, (33, 74)],
'Solexa': [64, (59, 104)],
'Illumina-1.3': [64, (64, 104)],
'Illumina-1.5': [64, (66, 105)]
}
"""
dict: Dictionary containing the encoding values for several fastq formats. The
key contains the format and the value contains a list with the corresponding
phred score and a list with the range of encodings.
"""
COPEN = {
"gz": gzip.open,
"bz2": bz2.open,
"zip": zipfile.ZipFile
}
MAGIC_DICT = {
b"\\x1f\\x8b\\x08": "gz",
b"\\x42\\x5a\\x68": "bz2",
b"\\x50\\x4b\\x03\\x04": "zip"
}
"""
dict: Dictionary containing the binary signatures for three compression formats
(gzip, bzip2 and zip).
"""
[docs]def guess_file_compression(file_path, magic_dict=None):
"""Guesses the compression of an input file.
This function guesses the compression of a given file by checking for
a binary signature at the beginning of the file. These signatures are
stored in the :py:data:`MAGIC_DICT` dictionary. The supported compression
formats are gzip, bzip2 and zip. If none of the signatures in this
dictionary are found at the beginning of the file, it returns ``None``.
Parameters
----------
file_path : str
Path to input file.
magic_dict : dict, optional
Dictionary containing the signatures of the compression types. The
key should be the binary signature and the value should be the
compression format. If left ``None``, it falls back to
:py:data:`MAGIC_DICT`.
Returns
-------
file_type : str or None
If a compression type is detected, returns a string with the format.
If not, returns ``None``.
"""
if not magic_dict:
magic_dict = MAGIC_DICT
max_len = max(len(x) for x in magic_dict)
with open(file_path, "rb") as f:
file_start = f.read(max_len)
logger.debug("Binary signature start: {}".format(file_start))
for magic, file_type in magic_dict.items():
if file_start.startswith(magic):
return file_type
return None
[docs]def get_qual_range(qual_str):
""" Get range of the Unicode encode range for a given string of characters.
The encoding is determined from the result of the :py:func:`ord` built-in.
Parameters
----------
qual_str : str
Arbitrary string.
Returns
-------
x : tuple
(Minimum Unicode code, Maximum Unicode code).
"""
vals = [ord(c) for c in qual_str]
return min(vals), max(vals)
[docs]def get_encodings_in_range(rmin, rmax):
""" Returns the valid encodings for a given encoding range.
The encoding ranges are stored in the :py:data:`RANGES` dictionary, with
the encoding name as a string and a list as a value containing the
phred score and a tuple with the encoding range. For a given encoding
range provided via the two first arguments, this function will return
all possible encodings and phred scores.
Parameters
----------
rmin : int
Minimum Unicode code in range.
rmax : int
Maximum Unicode code in range.
Returns
-------
valid_encodings : list
List of all possible encodings for the provided range.
valid_phred : list
List of all possible phred scores.
"""
valid_encodings = []
valid_phred = []
for encoding, (phred, (emin, emax)) in RANGES.items():
if rmin >= emin and rmax <= emax:
valid_encodings.append(encoding)
valid_phred.append(phred)
return valid_encodings, valid_phred
@MainWrapper
def main(fastq_id, fastq_pair, gsize, minimum_coverage, opts):
""" Main executor of the integrity_coverage template.
Parameters
----------
fastq_id : str
Sample Identification string.
fastq_pair : list
Two element list containing the paired FastQ files.
gsize : float or int
Estimate of genome size in Mb.
minimum_coverage : float or int
Minimum coverage required for a sample to pass the coverage check
opts : list
List of arbitrary options. See `Expected input`_.
"""
logger.info("Starting integrity coverage main")
# Check for runtime options
if "-e" in opts:
skip_encoding = True
else:
skip_encoding = False
# Information for encoding guess
gmin, gmax = 99, 0
encoding = []
phred = None
# Information for coverage estimation
chars = 0
nreads = 0
# Information on maximum read length
max_read_length = 0
# Get compression of each FastQ pair file
file_objects = []
for fastq in fastq_pair:
logger.info("Processing file {}".format(fastq))
logger.info("[{}] Guessing file compression".format(fastq))
ftype = guess_file_compression(fastq)
# This can guess the compression of gz, bz2 and zip. If it cannot
# find the compression type, it tries to open a regular file
if ftype:
logger.info("[{}] Found file compression: {}".format(
fastq, ftype))
file_objects.append(COPEN[ftype](fastq, "rt"))
else:
logger.info("[{}] File compression not found. Assuming an "
"uncompressed file".format(fastq))
file_objects.append(open(fastq))
logger.info("Starting FastQ file parsing")
# The '*_encoding' file stores a string with the encoding ('Sanger')
# If no encoding is guessed, 'None' should be stored
# The '*_phred' file stores a string with the phred score ('33')
# If no phred is guessed, 'None' should be stored
# The '*_coverage' file stores the estimated coverage ('88')
# The '*_report' file stores a csv report of the file
# The '*_max_len' file stores a string with the maximum contig len ('155')
with open("{}_encoding".format(fastq_id), "w") as enc_fh, \
open("{}_phred".format(fastq_id), "w") as phred_fh, \
open("{}_coverage".format(fastq_id), "w") as cov_fh, \
open("{}_report".format(fastq_id), "w") as cov_rep, \
open("{}_max_len".format(fastq_id), "w") as len_fh, \
open(".report.json", "w") as json_report, \
open(".status", "w") as status_fh, \
open(".fail", "w") as fail_fh:
try:
# Iterate over both pair files sequentially using itertools.chain
for i, line in enumerate(chain(*file_objects)):
# Parse only every 4th line of the file for the encoding
# e.g.: AAAA/EEEEEEEEEEE<EEEEEEEEEEEEEEEEEEEEEEEEE (...)
if (i + 1) % 4 == 0 and not skip_encoding:
# It is important to strip() the line so that any newline
# character is removed and not accounted for in the
# encoding guess
lmin, lmax = get_qual_range(line.strip())
# Guess new encoding if the range expands the previously
# set boundaries of gmin and gmax
if lmin < gmin or lmax > gmax:
gmin, gmax = min(lmin, gmin), max(lmax, gmax)
encoding, phred = get_encodings_in_range(gmin, gmax)
logger.debug(
"Updating estimates at line {} with range {} to"
" '{}' (encoding) and '{}' (phred)".format(
i, [lmin, lmax], encoding, phred))
# Parse only every 2nd line of the file for the coverage
# e.g.: GGATAATCTACCTTGACGATTTGTACTGGCGTTGGTTTCTTA (...)
if (i + 3) % 4 == 0:
read_len = len(line.strip())
chars += read_len
nreads += 1
# Evaluate maximum read length for sample
if read_len > max_read_length:
logger.debug("Updating maximum read length at line "
"{} to {}".format(i, read_len))
max_read_length = read_len
# End of FastQ parsing
logger.info("Finished FastQ file parsing")
# The minimum expected coverage for a sample to pass
exp_coverage = round(chars / (gsize * 1e6), 2)
# Set json report
if "-e" not in opts:
json_dic = {
"tableRow": [
{"header": "Raw BP",
"value": chars,
"table": "assembly",
"columnBar": True},
{"header": "Reads",
"value": nreads,
"table": "assembly",
"columnBar": True},
{"header": "Coverage (1st)",
"value": exp_coverage,
"table": "assembly",
"columnBar": True}
],
"plotData": {
"sparkline": chars
},
"minCoverage": minimum_coverage
}
else:
json_dic = {
"tableRow": [
{"header": "Coverage (2nd)",
"value": exp_coverage,
"table": "assembly",
"columnBar": True},
],
"minCoverage": minimum_coverage
}
# Get encoding
if len(encoding) > 1:
encoding = set(encoding)
phred = set(phred)
# Get encoding and phred as strings
# e.g. enc: Sanger, Illumina-1.8
# e.g. phred: 64
enc = "{}".format(",".join([x for x in encoding]))
phred = "{}".format(",".join(str(x) for x in phred))
logger.info("Encoding set to {}".format(enc))
logger.info("Phred set to {}".format(enc))
enc_fh.write(enc)
phred_fh.write(phred)
# Encoding not found
else:
logger.warning("Could not guess encoding and phred from "
"FastQ")
enc_fh.write("None")
phred_fh.write("None")
# Estimate coverage
logger.info("Estimating coverage based on a genome size of "
"{}".format(gsize))
logger.info("Expected coverage is {}".format(exp_coverage))
if exp_coverage >= minimum_coverage:
cov_rep.write("{},{},{}\\n".format(
fastq_id, str(exp_coverage), "PASS"))
cov_fh.write(str(exp_coverage))
status_fh.write("pass")
# Estimated coverage does not pass minimum threshold
else:
fail_msg = "Sample with low coverage ({}), below the {} " \
"threshold".format(exp_coverage, minimum_coverage)
logger.error(fail_msg)
fail_fh.write(fail_msg)
cov_fh.write("fail")
status_fh.write("fail")
cov_rep.write("{},{},{}\\n".format(
fastq_id, str(exp_coverage), "FAIL"))
json_dic["fail"] = {
"process": "integrityCoverage",
"value": fail_msg
}
json_report.write(json.dumps(json_dic, separators=(",", ":")))
# Maximum read length
len_fh.write("{}".format(max_read_length))
# This exception is raised when the input FastQ files are corrupted
except EOFError:
logger.error("The FastQ files could not be correctly "
"parsed. They may be corrupt")
for fh in [enc_fh, phred_fh, cov_fh, cov_rep, len_fh]:
fh.write("corrupt")
status_fh.write("fail")
fail_fh.write("Could not read/parse FastQ. "
"Possibly corrupt file")
if __name__ == "__main__":
main(FASTQ_ID, FASTQ_PAIR, GSIZE, MINIMUM_COVERAGE, OPTS)